Федеральное государственное бюджетное



страница8/18
Дата04.05.2016
Размер1.6 Mb.
1   ...   4   5   6   7   8   9   10   11   ...   18

2.2. Экстракция ДНК


ДНК амфипод и исследуемых паразитов экстрагировали по модифицированному методу Дойла и Диксона [171].

  1. Фиксированный спиртом образец отмывали дистиллированной водой три раза по 20 минут.

  2. Образец заливали 100-500 мкл (в зависимости от размера образца) лизирующего раствора (100mM Трис HCl – 1 мл, 1,4М NaCl – 8,19 (на 100 мл), 0,5 ЭДТА – 8 мл, ЦТАБ – 2 г) и гомогенезировали.

  3. Прогревали в водяном термостате при температуре 60ºС два часа, периодически встряхивая.

  4. Затем добавляли 100-500 мкл хлороформа и 40 минут встряхивали на шейкере.

  5. Центрифугировали 10 минут. Отбирали аккуратно верхнюю фазу, добавляли к ней равный объем изопропанола или этилового спирта и оставляли при -20 ºС на час.

  6. Центрифугировали 5-10 минут и отбирали надосадочную жидкость. ДНК выпадает в осадок.

  7. Промывали ДНК четыре раза 70% этанолом и подсушивали 20-30 минут при температуре 37 ºС.

  8. После того, как ДНК высохнет, добавляли 50-100 мкл дистиллированной воды (в зависимости от количества ДНК) и растворяли в термостате при температуре 37 ºС.



    1. 2.3. Молекулярные методы диагностики микроспоридий


Наряду с использованием традиционных методов диагностики [207] существует необходимость в более быстрых, более специфичных и более доступных подходах к диагностике, как клинических образцов, так и проб окружающей среды. По сравнению с традиционными культуральными и микроскопическими методами, молекулярные методы имеют следующие преимущества: повышенную чувствительность (за счет силы увеличения/амплификации сигнала); большую специфичность (когда используются подходящие для выявления пробы); меньшую зависимость от субъективности наблюдателя и более короткий промежуток времени до получения результата и более легкое объяснение для не специалистов. Кроме того, усовершенствованные методы, основанные на нуклеотидах, такие как реал-тайм ПЦР (полимеразная цепная реакция в реальном времени) и олигонуклеотидные микрозонды, являются количественными и более высокопроизводительными, делая возможным одновременный анализ образцов для разнообразных патогенов, а также экспериментальную оценку интенсивности инфекции [214]. ПЦР – наиболее часто используемый молекулярный метод. Техника подготовки образцов для молекулярной диагностики микроспоридий детально рассмотрена Вайсом и Восбринком [410]. На современном этапе обнаружение микроспоридий производится по гену малой субъединицы рибосомальной рРНК (SSU-rRNA) [404]. Стоит отметить, что филогенетический анализ последовательностей генов SSU-rRNA микроспоридий часто несовместим с традиционной классификацией, исторически основанной на морфологических характеристиках, установленных с помощью ТЭМ.

Метод ПЦР также пригоден для идентификации ранее неизвестных видов микроспоридий. Используя филогенетически консервативные праймеры, амплифицирующие малую субъединицу, большую субъединицу и межгенные регионы, возможно секвенировать части рРНК гена еще не охарактеризованных микроспоридий. Эти данные по последовательностям рРНК можно затем использовать для филогенетического анализа, используя BLAST, сравнивая неизвестные последовательности с рРНК последовательностями различных микроспоридий, доступными в GenBank.


    1. 2.4. Амплификация ДНК


Нуклеотидные последовательности фрагмента гена СО1 для амфиподы Gmelinoides fasciatus амплифицировали ПЦР-методом с использованием пары универсальных для беспозвоночных праймеров, фланкирующих фрагмент ДНК размером 710 п.н. [198] и имеющих следующую структуру:

L1490: 5’ – GGTCAACAAATCATAAAGATATTGG – 3’

H2198: 5’ – TAAACTTCAGGGTGACCAAAAAATGA – 3’

Параметры при 35 циклах амплификации были следующими: денатурация ДНК при 94ºС – 1 минута (2 минуты на первом цикле), отжиг праймеров при 46ºС – 2 минуты, элонгация нуклеотидной цепи при 72ºС – 1 минута 30 с (3 минуты на последнем цикле).

Амплификацию малой субъединицы рДНК микроспоридий проводили методом «nested» (двустадийной) ПЦР при помощи праймеров V1f [403] и 1342r [292] и внутренними праймерами 18sf [114] и 981r [278], имеющих следующую структуру:

V1f: 5’ – CACCAGGTTGATTCTGCCTGAC – 3’

1342r: 5’ – ACGGGCGGTGTGTACAAAGAACAG – 3’

18sf: 5’ – GTTGATTCTGCCTGACGT – 3’

981r: 5’ – TGGTAAGCTGTCCCGCGTTGAGTC – 3’

Двустадийная (nested) ПЦР – применяется для уменьшения числа побочных продуктов реакции. Используют две пары праймеров и проводят две последовательные реакции. Вторая пара праймеров амплифицирует участок ДНК внутри продукта первой реакции.

ПЦР-реакция для V1f - 1342r пары праймеров проводилась со следующим температурным профилем: 5 мин при 94С с последующими 40 циклами, состоящими из 50 с при 94ºС, 1 мин при 50ºС, 1 мин 30 с при 72ºС, постэлонгация проводилась при 72ºС в течение 7 мин. Полученный ПЦР-продукт использовался в амплификации с 18sf - 981r парой праймеров при следующих условиях: 5 мин при 94ºС с последующими 40 циклами, состоящими из 50 с при 94ºС, 1 мин при 48ºС, 1 мин при 72ºС, постэлонгация проводилась при 72ºС в течение 7 мин. (амплификатор «БИС», Россия).

    1. 2.5. Методы очистки амплифицированных фрагментов


Продукты реакции разделяли электрофоретически [72] в 1%-ном агарозном геле. Полосу ожидаемого размера вырезали и очищали согласно Т. Маниатису и соавторам [280].

Очистка амплифицированных фрагментов сорбцией на силикагеле

К ПЦР-продукту добавляли 5 мкл раствора силики с диаметром частиц 0,5-10 мкл (Helicon, США) и медленно перемешивали, затем добавляли 4 объема гуанидина тиоцианата (ГТЦ) и центрифугировали 20 сек на малых оборотах. Аккуратно отбирали супернатант и к осадку добавляли 200 мкл 80% этанола, операцию повторяли 3 раза. Осадки подсущивали в течение 20 – 30 мин, растворяли в 20 мкл дистиллированной воды, перемешивали и центрифугировали при 14000 об/мин 30 сек, отбирали водную фазу и проверяли качество очистки в 1%-ном агарозном геле.


Очистка амплифицированных фрагментов с использованием набора

ПЦР-продукт очищали набором «QIAquick PCR Purification Kit» фирмы QIAGEN (Valencia, CA) по протоколу фирмы-производителя. Отцентрифугированный очищенный раствор ДНК проверяли в 1%-ном агарозном геле на качество очистки и концентрацию ДНК.



1   ...   4   5   6   7   8   9   10   11   ...   18


База данных защищена авторским правом ©bezogr.ru 2016
обратиться к администрации

    Главная страница